def rnatoaa(rna): # A Procedure to turn RNA into Protein. # A tuple of all Legal Codons. Legal_Codons = ( "UUU", "UUC", "UUA", "UUG", "UCU", "UCC", "UCA", "UCG", "UAU", "UAC", "UAA", "UAG", "UGU", "UGC", "UGA", "UGG", "CUU", "CUC", "CUA", "CUG", "CCU", "CCC", "CCA", "CCG", "CAU", "CAC", "CAA", "CAG", "CGU", "CGC", "CGA", "CGG", "AUU", "AUC", "AUA", "AUG", "ACU", "ACC", "ACA", "ACG", "AAU", "AAC", "AAA", "AAG", "AGU", "AGC", "AGA", "AGG", "GUU", "GUC", "GUA", "GUG", "GCU", "GCC", "GCA", "GCG", "GAU", "GAC", "GAA", "GAG", "GGU", "GGC", "GGA", "GGG") # A Dictionary to assosiate Codons with Amino Acid Codes. Gencode = { "UUU":"F", "UUC":"F", "UUA":"L", "UUG":"L", "UCU":"S", "UCC":"s", "UCA":"S", "UCG":"S", "UAU":"Y", "UAC":"Y", "UAA":"*", "UAG":"*", "UGU":"C", "UGC":"C", "UGA":"*", "UGG":"W", "CUU":"L", "CUC":"L", "CUA":"L", "CUG":"L", "CCU":"P", "CCC":"P", "CCA":"P", "CCG":"P", "CAU":"H", "CAC":"H", "CAA":"Q", "CAG":"Q", "CGU":"R", "CGC":"R", "CGA":"R", "CGG":"R", "AUU":"I", "AUC":"I", "AUA":"I", "AUG":"M", "ACU":"T", "ACC":"T", "ACA":"T", "ACG":"T", "AAU":"N", "AAC":"N", "AAA":"K", "AAG":"K", "AGU":"S", "AGC":"S", "AGA":"R", "AGG":"R", "GUU":"V", "GUC":"V", "GUA":"V", "GUG":"V", "GCU":"A", "GCC":"A", "GCA":"A", "GCG":"A", "GAU":"D", "GAC":"D", "GAA":"E", "GAG":"E", "GGU":"G", "GGC":"G", "GGA":"G", "GGG":"G"} # First check for impossible Bases, Issue a Warning if found and continue if not rna.isalpha(): print("Warning - This Sequence contains non-alpha Characters?!") RNA=rna.upper() # All Upper Case, as Dictionary expects. RNA=RNA.replace("T","U") # All "T"s "U"s, as Dictionary expects. RNA_Length = len(RNA) # Compute the Length of the Sequence. Codon_Count = RNA_Length // 3 # Compute the Number of Codons. Spare_Bases = RNA_Length % 3 # Compute the Number of Bases left over. CDS_Length = RNA_Length - Spare_Bases # Compute the Length of the Coding Sequence. for Codon_Start in range( 0, CDS_Length, 3): # Along the CDS, Next_Codon = RNA[Codon_Start:Codon_Start + 3] # pick the Codon. if Next_Codon in Legal_Codons: # If the codon is good, print(Gencode[Next_Codon], end='') # print its corresponding aa code. else: # Otherwise, print("?", end='') # print a query. for Extra_Bases in range(Spare_Bases): # Print "."s to indicate print(".", end='') # Spare_Bases. print() # Done! Print a Newline to celebrate. #TEST BED #======== Sequences = ("AGCGACTCGATGCATGACGCACGCGATATCGAGCTATAG", # All Good "AGCGACTCGGACGCACGCGATATCGAGCTATAGGA", # 2 extra Bases "gcgCGCCGCAGCCCCCCccccccGGTGTAGACTGCA", # Some Lower Case "gcgCGCCGCAGCCCCC123CCCCGGTGTAGACTGCA", # Some Numeric "acagggtcgcgcGCATTTCHchshahGGACTTTTACAS") # Some illegal BP codes for Sequence in Sequences: rnatoaa(Sequence)